Meine Merkliste
my.bionity.com  
Login  

Telomer



Die Telomere sind die natürlichen einzelsträngigen Chromosomenenden linearer Chromosomen. Sie sind für die Stabilität von Chromosomen wesentliche Strukturelemente der DNA. Sie besitzen einen hohen Guanin- und Thymin-Anteil, der hochrepetitiv (oft wiederholt) ist. Bei allen Wirbeltieren findet man z. B. die Nukleotid-Sequenz TTAGGG mehr als 3000-mal wiederholt (in gezüchteten Labormäusen bis zu 4000-mal). Für den Stabilisierungseffekt ist auch die gefaltete Sekundärstruktur der Telomere wichtig. Zudem sind in einigen Organismen die Telomere ein Verankerungspunkt an die Zellkernwand.

Weiteres empfehlenswertes Fachwissen

Inhaltsverzeichnis

Struktur der Telomere

Die exakte räumliche Struktur der Telomere ist bisher noch nicht endgültig geklärt. Sie hängt von der Basensequenz ab, sodass durchaus mehrere Bindungsmotive auftreten können.

Bei höheren Eukaryoten findet man ein typisches thymin- und guaninreiches Motiv, von dem man ausgeht, dass es eine Quadrupelhelix ausbildet. Dabei paart sich zuerst der 3'-überlappende Strang mit sich selbst und bildet abnormale GG-Doppelbindungen aus. Dieser Doppelstrang paart erneut mit sich selbst und bildet eine Quadrupelhelix aus, bei der die Guanine sogenannte Hoogsteen-Bindungen eingehen.

Diese DNA-Sequenz wird von spezifischen-DNA bindenden Proteinen erkannt und gebunden. Dieser Proteinkomplex hat die Aufgabe es der Zelle zu ermöglichen das natürliche Chromosomenende von ungewollten DNA-Strangbrüchen zu unterscheiden.

Telomere bei der Replikation

Mit jeder Zellteilung werden die Telomere verkürzt, da die DNA-Polymerase am Folgestrang nicht mehr ansetzen kann. Unterschreitet die Telomerlänge ein kritisches Minimum von circa 4 kbp, kann sich die Zelle nicht mehr weiter teilen, oft tritt dann der programmierte Zelltod (Apoptose) oder ein permanenter Wachstumsstopp ein (Seneszenz). Die hierdurch entstehende Begrenzung der zellulären Lebenszeit wird als Tumorsupressor-Mechanismus verstanden. Das Enzym Telomerase (ein RNA-Protein-Komplex mit einer reverse-Transkriptase-Aktivität) kann die Verkürzung wieder ausgleichen. Dazu fügt sie an des 3'-OH-Ende G-reiche Wiederholungseinheiten an, deren RNA-Vorlage sich in der Telomerase selbst befindet. Danach klappt der leading-strand um und bildet mit sich selbst abnormale GG-Basenpaarungen aus. Von diesem Punkt aus können die RNA-Primase und die DNA-Polymerase den lagging strand auffüllen.
Zellen, in denen dieses Enzym aktiv ist, können sich sehr viel häufiger teilen als andere Körperzellen. Aktiv ist die Telomerase prinzipiell bei einzelligen Eukaryoten (Protozoen), bei höheren mehrzelligen Organismen jedoch nur in ganz bestimmten Zellen:

Es hat sich allerdings bei Knock-out-Mäusen gezeigt, dass sie mehrere Generationen ohne Telomerase lebensfähig bleiben können. Es wird angenommen, dass die Reparatur der Telomere auch über Rekombinationereignisse vonstatten gehen kann, geklärt ist dies aber noch nicht.

Bedeutung

Die Bedeutung der Chromosomenenden für deren Stabilität erkannten erstmals die amerikanischen Nobelpreisträger Barbara McClintock und Hermann Joseph Muller, die auch den Begriff Telomer (griechisch: End-Teil) prägten. Telomere werden mit biologischen Vorgängen in Verbindung gebracht, die mit der Alterung von Zellen (Zellseneszenz), aber auch deren Immortalisierung (und damit auch Entstehung von Krebs) zusammenhängen.

Die Enzymaktivität der Telomerase lässt sich durch die TRAP-Methode feststellen.

Beispiele für Sequenzen von Telomeren bei verschiedenen Organismen
Gruppe (Reich, Stamm) Organismus Telomerische Wiederholungseinheit (5' nach 3')
Wirbeltiere Mensch, Maus, Xenopus TTAGGG
Filamentöse Pilze (Fungi) Neurospora crassa TTAGGG
Fadenwürmer (Nematoda) Caenorhabditis elegans TTAGGG
Schleimpilze Physarum, Didymium
Dictyostelium
TTAGGG
AG(1-8)
Kinetoplastiden (Protozoa) Trypanosoma, Crithidia TTAGGG
Ciliata (Wimpertierchen, Protozoa) Tetrahymena, Glaucoma
Paramecium
Oxytricha, Stylonychia, Euplotes
TTGGGG
TTGGG(T/G)
TTTTGGGG
Apicomplexa (Plasmodium, Protozoa) TTAGGG(T/C)
Höhere Pflanzen Arabidopsis thaliana TTTAGGG
Grünalgen Chlamydomonas TTTTAGGG
Insekten Bombyx mori TTAGG
Schlauchwürmer Ascaris lumbricoides TTAGGC
Spalt-Hefen (Schizosaccharomyces) Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Knospungs-Hefen Saccharomyces cerevisiae TGTGGGTGTGGTG (vom RNA-Template)

or G(2-3)(TG)(1-6)T (Konsensus)

Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

Literatur

  • Barbara McClintock (1941), The stability of broken ends of chromosomes in Zea mays, Genetics 26: 234-282
  • H. J. Müller (1938), The remaking of chromosomes, The Collecting Net-Woods Hole 13: 181-198
  • Epel ES, Blackburn EH et al.: "Accelerated telomere shortening in response to life stress." Proc Natl Acad Sci U S A. 2004 Dec 14;101(50):17323-4.
  • Mills M, Lacroix L et al.: "Unusual DNA Conformations: Implications for Telomeres" Current Medicinal Chemistry - Anti-Cancer Agents, Volume 2, Number 5, September 2002, pp. 627-644(18) Link
 
Dieser Artikel basiert auf dem Artikel Telomer aus der freien Enzyklopädie Wikipedia und steht unter der GNU-Lizenz für freie Dokumentation. In der Wikipedia ist eine Liste der Autoren verfügbar.
Ihr Bowser ist nicht aktuell. Microsoft Internet Explorer 6.0 unterstützt einige Funktionen auf Chemie.DE nicht.